ID: 1146616175

View in Genome Browser
Species Human (GRCh38)
Location 17:34359006-34359028
Sequence CTCAGGATTGGTAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146616168_1146616175 -7 Left 1146616168 17:34358990-34359012 CCAAGTCCTAGTGAGCCTCAGGA No data
Right 1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG No data
1146616166_1146616175 1 Left 1146616166 17:34358982-34359004 CCAGATGACCAAGTCCTAGTGAG No data
Right 1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG No data
1146616165_1146616175 20 Left 1146616165 17:34358963-34358985 CCTGACACTCAGAGGGAAACCAG No data
Right 1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146616175 Original CRISPR CTCAGGATTGGTAGGGAAGA GGG Intergenic
No off target data available for this crispr