ID: 1146624347

View in Genome Browser
Species Human (GRCh38)
Location 17:34424450-34424472
Sequence CTCAGGAAACACTGTTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146624347_1146624353 -1 Left 1146624347 17:34424450-34424472 CCCCCATAACAGTGTTTCCTGAG No data
Right 1146624353 17:34424472-34424494 GGACCAGAACCACCTCTTTGCGG No data
1146624347_1146624354 0 Left 1146624347 17:34424450-34424472 CCCCCATAACAGTGTTTCCTGAG No data
Right 1146624354 17:34424473-34424495 GACCAGAACCACCTCTTTGCGGG No data
1146624347_1146624359 19 Left 1146624347 17:34424450-34424472 CCCCCATAACAGTGTTTCCTGAG No data
Right 1146624359 17:34424492-34424514 CGGGGCACCTCCTCACTCCGCGG No data
1146624347_1146624355 1 Left 1146624347 17:34424450-34424472 CCCCCATAACAGTGTTTCCTGAG No data
Right 1146624355 17:34424474-34424496 ACCAGAACCACCTCTTTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146624347 Original CRISPR CTCAGGAAACACTGTTATGG GGG (reversed) Intergenic
No off target data available for this crispr