ID: 1146626853

View in Genome Browser
Species Human (GRCh38)
Location 17:34441588-34441610
Sequence TAGGGCTCAAAGGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146626853_1146626857 -9 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626857 17:34441602-34441624 TGAGCCCTAACCACAGGGACAGG No data
1146626853_1146626863 9 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data
1146626853_1146626862 8 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626862 17:34441619-34441641 GACAGGGTCTCATTCACCTATGG No data
1146626853_1146626864 15 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626853_1146626858 -8 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626858 17:34441603-34441625 GAGCCCTAACCACAGGGACAGGG No data
1146626853_1146626865 21 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626865 17:34441632-34441654 TCACCTATGGGTCCAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146626853 Original CRISPR TAGGGCTCAAAGGCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr