ID: 1146626857

View in Genome Browser
Species Human (GRCh38)
Location 17:34441602-34441624
Sequence TGAGCCCTAACCACAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146626850_1146626857 17 Left 1146626850 17:34441562-34441584 CCTGTTTGCAGGTCCGTCATCTG No data
Right 1146626857 17:34441602-34441624 TGAGCCCTAACCACAGGGACAGG No data
1146626852_1146626857 4 Left 1146626852 17:34441575-34441597 CCGTCATCTGGATCCTGCAGCAG No data
Right 1146626857 17:34441602-34441624 TGAGCCCTAACCACAGGGACAGG No data
1146626853_1146626857 -9 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626857 17:34441602-34441624 TGAGCCCTAACCACAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146626857 Original CRISPR TGAGCCCTAACCACAGGGAC AGG Intergenic
No off target data available for this crispr