ID: 1146626863

View in Genome Browser
Species Human (GRCh38)
Location 17:34441620-34441642
Sequence ACAGGGTCTCATTCACCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146626856_1146626863 -1 Left 1146626856 17:34441598-34441620 CCTTTGAGCCCTAACCACAGGGA No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data
1146626860_1146626863 -10 Left 1146626860 17:34441607-34441629 CCTAACCACAGGGACAGGGTCTC No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data
1146626852_1146626863 22 Left 1146626852 17:34441575-34441597 CCGTCATCTGGATCCTGCAGCAG No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data
1146626853_1146626863 9 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data
1146626859_1146626863 -9 Left 1146626859 17:34441606-34441628 CCCTAACCACAGGGACAGGGTCT No data
Right 1146626863 17:34441620-34441642 ACAGGGTCTCATTCACCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146626863 Original CRISPR ACAGGGTCTCATTCACCTAT GGG Intergenic
No off target data available for this crispr