ID: 1146626864

View in Genome Browser
Species Human (GRCh38)
Location 17:34441626-34441648
Sequence TCTCATTCACCTATGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146626852_1146626864 28 Left 1146626852 17:34441575-34441597 CCGTCATCTGGATCCTGCAGCAG No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626860_1146626864 -4 Left 1146626860 17:34441607-34441629 CCTAACCACAGGGACAGGGTCTC No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626856_1146626864 5 Left 1146626856 17:34441598-34441620 CCTTTGAGCCCTAACCACAGGGA No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626861_1146626864 -9 Left 1146626861 17:34441612-34441634 CCACAGGGACAGGGTCTCATTCA No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626859_1146626864 -3 Left 1146626859 17:34441606-34441628 CCCTAACCACAGGGACAGGGTCT No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data
1146626853_1146626864 15 Left 1146626853 17:34441588-34441610 CCTGCAGCAGCCTTTGAGCCCTA No data
Right 1146626864 17:34441626-34441648 TCTCATTCACCTATGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146626864 Original CRISPR TCTCATTCACCTATGGGTCC AGG Intergenic
No off target data available for this crispr