ID: 1146629956

View in Genome Browser
Species Human (GRCh38)
Location 17:34462734-34462756
Sequence AAGAGCAAACAGGATGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146629948_1146629956 16 Left 1146629948 17:34462695-34462717 CCTCATCAGACTTTGAGGATGTG No data
Right 1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG No data
1146629947_1146629956 20 Left 1146629947 17:34462691-34462713 CCAGCCTCATCAGACTTTGAGGA No data
Right 1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG No data
1146629945_1146629956 21 Left 1146629945 17:34462690-34462712 CCCAGCCTCATCAGACTTTGAGG No data
Right 1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG No data
1146629943_1146629956 28 Left 1146629943 17:34462683-34462705 CCCAACTCCCAGCCTCATCAGAC No data
Right 1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG No data
1146629944_1146629956 27 Left 1146629944 17:34462684-34462706 CCAACTCCCAGCCTCATCAGACT No data
Right 1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146629956 Original CRISPR AAGAGCAAACAGGATGATGG GGG Intergenic
No off target data available for this crispr