ID: 1146630151

View in Genome Browser
Species Human (GRCh38)
Location 17:34463808-34463830
Sequence GTGCTGTGACGGAGGTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630151_1146630157 -8 Left 1146630151 17:34463808-34463830 CCCCGCCACCTCCGTCACAGCAC No data
Right 1146630157 17:34463823-34463845 CACAGCACTAGCCACATTGCTGG No data
1146630151_1146630160 30 Left 1146630151 17:34463808-34463830 CCCCGCCACCTCCGTCACAGCAC No data
Right 1146630160 17:34463861-34463883 TCTGCCTTCCTCACTTGAGTGGG No data
1146630151_1146630159 29 Left 1146630151 17:34463808-34463830 CCCCGCCACCTCCGTCACAGCAC No data
Right 1146630159 17:34463860-34463882 ATCTGCCTTCCTCACTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630151 Original CRISPR GTGCTGTGACGGAGGTGGCG GGG (reversed) Intergenic
No off target data available for this crispr