ID: 1146630193

View in Genome Browser
Species Human (GRCh38)
Location 17:34464065-34464087
Sequence CCTCATCCTCTGTGCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630193_1146630207 26 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG No data
1146630193_1146630201 12 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630201 17:34464100-34464122 GCAGTCCCTGGCAGGCCTGTGGG No data
1146630193_1146630198 0 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630198 17:34464088-34464110 GATGTGCATCAGGCAGTCCCTGG No data
1146630193_1146630197 -10 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630197 17:34464078-34464100 GAGGATGAGGGATGTGCATCAGG No data
1146630193_1146630200 11 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630200 17:34464099-34464121 GGCAGTCCCTGGCAGGCCTGTGG No data
1146630193_1146630202 13 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630202 17:34464101-34464123 CAGTCCCTGGCAGGCCTGTGGGG No data
1146630193_1146630204 15 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630204 17:34464103-34464125 GTCCCTGGCAGGCCTGTGGGGGG No data
1146630193_1146630203 14 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630203 17:34464102-34464124 AGTCCCTGGCAGGCCTGTGGGGG No data
1146630193_1146630199 4 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630199 17:34464092-34464114 TGCATCAGGCAGTCCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630193 Original CRISPR CCTCATCCTCTGTGCCCTTT GGG (reversed) Intergenic
No off target data available for this crispr