ID: 1146630207

View in Genome Browser
Species Human (GRCh38)
Location 17:34464114-34464136
Sequence GCCTGTGGGGGGCACAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630195_1146630207 25 Left 1146630195 17:34464066-34464088 CCAAAGGGCACAGAGGATGAGGG No data
Right 1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG No data
1146630192_1146630207 27 Left 1146630192 17:34464064-34464086 CCCCAAAGGGCACAGAGGATGAG No data
Right 1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG No data
1146630193_1146630207 26 Left 1146630193 17:34464065-34464087 CCCAAAGGGCACAGAGGATGAGG No data
Right 1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630207 Original CRISPR GCCTGTGGGGGGCACAACAC TGG Intergenic
No off target data available for this crispr