ID: 1146630300

View in Genome Browser
Species Human (GRCh38)
Location 17:34464741-34464763
Sequence ACCCATGACAACAGATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630300_1146630304 19 Left 1146630300 17:34464741-34464763 CCTCTTCATCTGTTGTCATGGGT No data
Right 1146630304 17:34464783-34464805 CTCCTCCCAGAGCCTCCATGAGG No data
1146630300_1146630305 20 Left 1146630300 17:34464741-34464763 CCTCTTCATCTGTTGTCATGGGT No data
Right 1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630300 Original CRISPR ACCCATGACAACAGATGAAG AGG (reversed) Intergenic
No off target data available for this crispr