ID: 1146630301

View in Genome Browser
Species Human (GRCh38)
Location 17:34464769-34464791
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630301_1146630313 15 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630313 17:34464807-34464829 ACACCACTGTCAGTGGTCATGGG No data
1146630301_1146630311 8 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630311 17:34464800-34464822 ATGAGGGACACCACTGTCAGTGG No data
1146630301_1146630304 -9 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630304 17:34464783-34464805 CTCCTCCCAGAGCCTCCATGAGG No data
1146630301_1146630312 14 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630312 17:34464806-34464828 GACACCACTGTCAGTGGTCATGG No data
1146630301_1146630305 -8 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630301 Original CRISPR TGGGAGGAGTAGCAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr