ID: 1146630305

View in Genome Browser
Species Human (GRCh38)
Location 17:34464784-34464806
Sequence TCCTCCCAGAGCCTCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146630302_1146630305 -9 Left 1146630302 17:34464770-34464792 CCTTCTCCTGCTACTCCTCCCAG No data
Right 1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG No data
1146630301_1146630305 -8 Left 1146630301 17:34464769-34464791 CCCTTCTCCTGCTACTCCTCCCA No data
Right 1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG No data
1146630300_1146630305 20 Left 1146630300 17:34464741-34464763 CCTCTTCATCTGTTGTCATGGGT No data
Right 1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146630305 Original CRISPR TCCTCCCAGAGCCTCCATGA GGG Intergenic
No off target data available for this crispr