ID: 1146631028

View in Genome Browser
Species Human (GRCh38)
Location 17:34469385-34469407
Sequence CATTAGGGTTGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146631028_1146631035 17 Left 1146631028 17:34469385-34469407 CCAGCTTCCCTCCAACCCTAATG No data
Right 1146631035 17:34469425-34469447 ATCTGCACAACCCTCTATCAAGG No data
1146631028_1146631036 18 Left 1146631028 17:34469385-34469407 CCAGCTTCCCTCCAACCCTAATG No data
Right 1146631036 17:34469426-34469448 TCTGCACAACCCTCTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146631028 Original CRISPR CATTAGGGTTGGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr