ID: 1146631160

View in Genome Browser
Species Human (GRCh38)
Location 17:34470435-34470457
Sequence AGCAGGCATCTGGTCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146631156_1146631160 -1 Left 1146631156 17:34470413-34470435 CCAATAAAACTTTCTTCCTATAA No data
Right 1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146631160 Original CRISPR AGCAGGCATCTGGTCAGATT TGG Intergenic
No off target data available for this crispr