ID: 1146633229

View in Genome Browser
Species Human (GRCh38)
Location 17:34485341-34485363
Sequence AGGCTGACAGGGGATGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633229_1146633238 3 Left 1146633229 17:34485341-34485363 CCTATGGCATCCCCTGTCAGCCT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data
1146633229_1146633237 2 Left 1146633229 17:34485341-34485363 CCTATGGCATCCCCTGTCAGCCT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633229_1146633239 7 Left 1146633229 17:34485341-34485363 CCTATGGCATCCCCTGTCAGCCT No data
Right 1146633239 17:34485371-34485393 CTTTGCAGACGCAGACGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633229 Original CRISPR AGGCTGACAGGGGATGCCAT AGG (reversed) Intergenic