ID: 1146633233

View in Genome Browser
Species Human (GRCh38)
Location 17:34485351-34485373
Sequence AAGCCCCAGCAGGCTGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633233_1146633237 -8 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633233_1146633241 27 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633241 17:34485401-34485423 TCCTGAACTAAAGCTCACCTTGG No data
1146633233_1146633239 -3 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633239 17:34485371-34485393 CTTTGCAGACGCAGACGGGAAGG No data
1146633233_1146633238 -7 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633233 Original CRISPR AAGCCCCAGCAGGCTGACAG GGG (reversed) Intergenic