ID: 1146633234

View in Genome Browser
Species Human (GRCh38)
Location 17:34485352-34485374
Sequence AAAGCCCCAGCAGGCTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633234_1146633243 30 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633243 17:34485405-34485427 GAACTAAAGCTCACCTTGGAAGG No data
1146633234_1146633239 -4 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633239 17:34485371-34485393 CTTTGCAGACGCAGACGGGAAGG No data
1146633234_1146633237 -9 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633234_1146633241 26 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633241 17:34485401-34485423 TCCTGAACTAAAGCTCACCTTGG No data
1146633234_1146633238 -8 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633234 Original CRISPR AAAGCCCCAGCAGGCTGACA GGG (reversed) Intergenic