ID: 1146633235

View in Genome Browser
Species Human (GRCh38)
Location 17:34485353-34485375
Sequence CAAAGCCCCAGCAGGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633235_1146633241 25 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633241 17:34485401-34485423 TCCTGAACTAAAGCTCACCTTGG No data
1146633235_1146633244 30 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633244 17:34485406-34485428 AACTAAAGCTCACCTTGGAAGGG No data
1146633235_1146633238 -9 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data
1146633235_1146633237 -10 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633235_1146633243 29 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633243 17:34485405-34485427 GAACTAAAGCTCACCTTGGAAGG No data
1146633235_1146633239 -5 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633239 17:34485371-34485393 CTTTGCAGACGCAGACGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633235 Original CRISPR CAAAGCCCCAGCAGGCTGAC AGG (reversed) Intergenic