ID: 1146633237

View in Genome Browser
Species Human (GRCh38)
Location 17:34485366-34485388
Sequence TGGGGCTTTGCAGACGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633229_1146633237 2 Left 1146633229 17:34485341-34485363 CCTATGGCATCCCCTGTCAGCCT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633235_1146633237 -10 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633233_1146633237 -8 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data
1146633234_1146633237 -9 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633237 17:34485366-34485388 TGGGGCTTTGCAGACGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633237 Original CRISPR TGGGGCTTTGCAGACGCAGA CGG Intergenic