ID: 1146633238

View in Genome Browser
Species Human (GRCh38)
Location 17:34485367-34485389
Sequence GGGGCTTTGCAGACGCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633234_1146633238 -8 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data
1146633229_1146633238 3 Left 1146633229 17:34485341-34485363 CCTATGGCATCCCCTGTCAGCCT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data
1146633235_1146633238 -9 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data
1146633233_1146633238 -7 Left 1146633233 17:34485351-34485373 CCCCTGTCAGCCTGCTGGGGCTT No data
Right 1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633238 Original CRISPR GGGGCTTTGCAGACGCAGAC GGG Intergenic