ID: 1146633243

View in Genome Browser
Species Human (GRCh38)
Location 17:34485405-34485427
Sequence GAACTAAAGCTCACCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146633235_1146633243 29 Left 1146633235 17:34485353-34485375 CCTGTCAGCCTGCTGGGGCTTTG No data
Right 1146633243 17:34485405-34485427 GAACTAAAGCTCACCTTGGAAGG No data
1146633234_1146633243 30 Left 1146633234 17:34485352-34485374 CCCTGTCAGCCTGCTGGGGCTTT No data
Right 1146633243 17:34485405-34485427 GAACTAAAGCTCACCTTGGAAGG No data
1146633236_1146633243 21 Left 1146633236 17:34485361-34485383 CCTGCTGGGGCTTTGCAGACGCA No data
Right 1146633243 17:34485405-34485427 GAACTAAAGCTCACCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146633243 Original CRISPR GAACTAAAGCTCACCTTGGA AGG Intergenic