ID: 1146633244 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:34485406-34485428 |
Sequence | AACTAAAGCTCACCTTGGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146633235_1146633244 | 30 | Left | 1146633235 | 17:34485353-34485375 | CCTGTCAGCCTGCTGGGGCTTTG | No data | ||
Right | 1146633244 | 17:34485406-34485428 | AACTAAAGCTCACCTTGGAAGGG | No data | ||||
1146633236_1146633244 | 22 | Left | 1146633236 | 17:34485361-34485383 | CCTGCTGGGGCTTTGCAGACGCA | No data | ||
Right | 1146633244 | 17:34485406-34485428 | AACTAAAGCTCACCTTGGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146633244 | Original CRISPR | AACTAAAGCTCACCTTGGAA GGG | Intergenic | ||