ID: 1146636888

View in Genome Browser
Species Human (GRCh38)
Location 17:34513194-34513216
Sequence TGCACAGGTTTGGAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636888_1146636893 22 Left 1146636888 17:34513194-34513216 CCTGCAGCCTCCAAACCTGTGCA No data
Right 1146636893 17:34513239-34513261 GCAGCAGCCAAAGGTTCCACTGG No data
1146636888_1146636894 23 Left 1146636888 17:34513194-34513216 CCTGCAGCCTCCAAACCTGTGCA No data
Right 1146636894 17:34513240-34513262 CAGCAGCCAAAGGTTCCACTGGG No data
1146636888_1146636892 13 Left 1146636888 17:34513194-34513216 CCTGCAGCCTCCAAACCTGTGCA No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636888_1146636895 24 Left 1146636888 17:34513194-34513216 CCTGCAGCCTCCAAACCTGTGCA No data
Right 1146636895 17:34513241-34513263 AGCAGCCAAAGGTTCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636888 Original CRISPR TGCACAGGTTTGGAGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr