ID: 1146636890

View in Genome Browser
Species Human (GRCh38)
Location 17:34513204-34513226
Sequence AAGCTAAGAGTGCACAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636890_1146636895 14 Left 1146636890 17:34513204-34513226 CCAAACCTGTGCACTCTTAGCTT No data
Right 1146636895 17:34513241-34513263 AGCAGCCAAAGGTTCCACTGGGG No data
1146636890_1146636892 3 Left 1146636890 17:34513204-34513226 CCAAACCTGTGCACTCTTAGCTT No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636890_1146636893 12 Left 1146636890 17:34513204-34513226 CCAAACCTGTGCACTCTTAGCTT No data
Right 1146636893 17:34513239-34513261 GCAGCAGCCAAAGGTTCCACTGG No data
1146636890_1146636894 13 Left 1146636890 17:34513204-34513226 CCAAACCTGTGCACTCTTAGCTT No data
Right 1146636894 17:34513240-34513262 CAGCAGCCAAAGGTTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636890 Original CRISPR AAGCTAAGAGTGCACAGGTT TGG (reversed) Intergenic
No off target data available for this crispr