ID: 1146636892

View in Genome Browser
Species Human (GRCh38)
Location 17:34513230-34513252
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636887_1146636892 16 Left 1146636887 17:34513191-34513213 CCACCTGCAGCCTCCAAACCTGT No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636888_1146636892 13 Left 1146636888 17:34513194-34513216 CCTGCAGCCTCCAAACCTGTGCA No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636890_1146636892 3 Left 1146636890 17:34513204-34513226 CCAAACCTGTGCACTCTTAGCTT No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636886_1146636892 17 Left 1146636886 17:34513190-34513212 CCCACCTGCAGCCTCCAAACCTG No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636889_1146636892 6 Left 1146636889 17:34513201-34513223 CCTCCAAACCTGTGCACTCTTAG No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data
1146636891_1146636892 -2 Left 1146636891 17:34513209-34513231 CCTGTGCACTCTTAGCTTGAAAT No data
Right 1146636892 17:34513230-34513252 ATTAATTTAGCAGCAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636892 Original CRISPR ATTAATTTAGCAGCAGCCAA AGG Intergenic
No off target data available for this crispr