ID: 1146636963

View in Genome Browser
Species Human (GRCh38)
Location 17:34513688-34513710
Sequence CATGCTAACCAATGGCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636963_1146636968 -1 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636968 17:34513710-34513732 GGATCCACTACCAGGAGGTGAGG No data
1146636963_1146636973 27 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636973 17:34513738-34513760 TGTTCTTGTGTATAAATGGTTGG No data
1146636963_1146636972 23 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data
1146636963_1146636974 28 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636974 17:34513739-34513761 GTTCTTGTGTATAAATGGTTGGG No data
1146636963_1146636975 29 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636975 17:34513740-34513762 TTCTTGTGTATAAATGGTTGGGG No data
1146636963_1146636967 -6 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636967 17:34513705-34513727 AGCATGGATCCACTACCAGGAGG No data
1146636963_1146636969 0 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636969 17:34513711-34513733 GATCCACTACCAGGAGGTGAGGG No data
1146636963_1146636966 -9 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636966 17:34513702-34513724 GTTAGCATGGATCCACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636963 Original CRISPR CATGCTAACCAATGGCCTTT AGG (reversed) Intergenic
No off target data available for this crispr