ID: 1146636971

View in Genome Browser
Species Human (GRCh38)
Location 17:34513720-34513742
Sequence GAACAGTAGCCCTCACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636971_1146636977 15 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636977 17:34513758-34513780 TGGGGACAGTCCCCCTGTTTGGG No data
1146636971_1146636972 -9 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data
1146636971_1146636974 -4 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636974 17:34513739-34513761 GTTCTTGTGTATAAATGGTTGGG No data
1146636971_1146636973 -5 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636973 17:34513738-34513760 TGTTCTTGTGTATAAATGGTTGG No data
1146636971_1146636975 -3 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636975 17:34513740-34513762 TTCTTGTGTATAAATGGTTGGGG No data
1146636971_1146636976 14 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636976 17:34513757-34513779 TTGGGGACAGTCCCCCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636971 Original CRISPR GAACAGTAGCCCTCACCTCC TGG (reversed) Intergenic
No off target data available for this crispr