ID: 1146636972

View in Genome Browser
Species Human (GRCh38)
Location 17:34513734-34513756
Sequence CTACTGTTCTTGTGTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146636963_1146636972 23 Left 1146636963 17:34513688-34513710 CCTAAAGGCCATTGGTTAGCATG No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data
1146636971_1146636972 -9 Left 1146636971 17:34513720-34513742 CCAGGAGGTGAGGGCTACTGTTC No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data
1146636965_1146636972 15 Left 1146636965 17:34513696-34513718 CCATTGGTTAGCATGGATCCACT No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data
1146636970_1146636972 -3 Left 1146636970 17:34513714-34513736 CCACTACCAGGAGGTGAGGGCTA No data
Right 1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146636972 Original CRISPR CTACTGTTCTTGTGTATAAA TGG Intergenic
No off target data available for this crispr