ID: 1146641783

View in Genome Browser
Species Human (GRCh38)
Location 17:34547332-34547354
Sequence GGGCAGTGGCCTTGTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146641776_1146641783 18 Left 1146641776 17:34547291-34547313 CCTCTGCTCCAATCAGAAAGGCT No data
Right 1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG No data
1146641777_1146641783 10 Left 1146641777 17:34547299-34547321 CCAATCAGAAAGGCTAGAGTAAA No data
Right 1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146641783 Original CRISPR GGGCAGTGGCCTTGTTTTGC AGG Intergenic
No off target data available for this crispr