ID: 1146643855

View in Genome Browser
Species Human (GRCh38)
Location 17:34563338-34563360
Sequence TGGGCATCCCCAGATCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146643846_1146643855 15 Left 1146643846 17:34563300-34563322 CCGCAAACTATGGTTGCCTCTGG No data
Right 1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG No data
1146643845_1146643855 16 Left 1146643845 17:34563299-34563321 CCCGCAAACTATGGTTGCCTCTG No data
Right 1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG No data
1146643852_1146643855 -10 Left 1146643852 17:34563325-34563347 CCAGAATGATTCGTGGGCATCCC No data
Right 1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG No data
1146643844_1146643855 21 Left 1146643844 17:34563294-34563316 CCTCTCCCGCAAACTATGGTTGC No data
Right 1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG No data
1146643849_1146643855 -1 Left 1146643849 17:34563316-34563338 CCTCTGGGTCCAGAATGATTCGT No data
Right 1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146643855 Original CRISPR TGGGCATCCCCAGATCAGGT GGG Intergenic
No off target data available for this crispr