ID: 1146646852

View in Genome Browser
Species Human (GRCh38)
Location 17:34581702-34581724
Sequence GCCGGCTTAGGCGAGCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146646845_1146646852 6 Left 1146646845 17:34581673-34581695 CCCGCGGTCCTGTGAGCTGCATC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1146646842_1146646852 23 Left 1146646842 17:34581656-34581678 CCGCCGCGGCTCGCACGCCCGCG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1146646846_1146646852 5 Left 1146646846 17:34581674-34581696 CCGCGGTCCTGTGAGCTGCATCT 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1146646844_1146646852 20 Left 1146646844 17:34581659-34581681 CCGCGGCTCGCACGCCCGCGGTC 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1146646848_1146646852 -2 Left 1146646848 17:34581681-34581703 CCTGTGAGCTGCATCTAAATGGC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146646852 Original CRISPR GCCGGCTTAGGCGAGCCCGG AGG Intronic
900202706 1:1418296-1418318 GGCGGCTTAGGCCTGCCCCGTGG - Intergenic
900548299 1:3241055-3241077 GGCGGCTCAGGCGAGGCTGGGGG + Intronic
900912650 1:5612511-5612533 GCAGGCTTAAGCCAGCCCTGGGG + Intergenic
901022709 1:6263104-6263126 GCTGGCTGAGGCCAGCCCCGGGG + Intergenic
905863325 1:41364255-41364277 GCCGGCTTTGGAGACCCTGGAGG - Intronic
921065128 1:211617115-211617137 GCCAGCTCAGGGGAGCCTGGGGG + Intergenic
1065930752 10:30476624-30476646 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
1069938888 10:71939898-71939920 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
1071288580 10:84171905-84171927 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1071532442 10:86400526-86400548 GCGCGCTCAGGCGAGCTCGGCGG - Intergenic
1077408021 11:2391312-2391334 GCCGGCTGAGGGAAGCCCTGAGG - Intronic
1083669318 11:64291538-64291560 GCCGGCTGTGGGGAGCCAGGCGG + Intronic
1084563869 11:69918842-69918864 GCCTCCTCAGGCGAGGCCGGGGG + Intergenic
1086973760 11:93110338-93110360 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1098248078 12:68540749-68540771 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
1105578453 13:21673786-21673808 GCCGGCCTAGGTGTGCCAGGCGG + Intronic
1107935247 13:45340921-45340943 GCGGTCTTAGCCGAGCGCGGAGG - Intronic
1117562170 14:56951783-56951805 GCCGGCTAATGCGAGCCCAGCGG - Intergenic
1121190645 14:92026469-92026491 GCCGGCTGCGGCGAGCAAGGAGG - Intronic
1122127778 14:99588371-99588393 GCAGGCTTAGGAGCACCCGGCGG - Intronic
1122812105 14:104294161-104294183 TCCGGCTAAATCGAGCCCGGTGG - Intergenic
1122913161 14:104843602-104843624 GGCGGGGCAGGCGAGCCCGGGGG - Intergenic
1123010959 14:105349272-105349294 GCCGGCTAGGGAGAGCCCGCTGG - Intronic
1130115307 15:81000963-81000985 GGCGGCGGCGGCGAGCCCGGGGG + Exonic
1130224416 15:82046319-82046341 GCGGGCTGCGGCGAGCGCGGGGG - Intergenic
1133324731 16:4936056-4936078 ACCGGTTTAGGGGAGCCTGGTGG - Intronic
1139636791 16:68263160-68263182 GCCGGCTCAGCCGGGCCTGGTGG - Intergenic
1141829879 16:86504291-86504313 GCCGGCTCAGGCGACACCTGCGG - Intergenic
1142150453 16:88510308-88510330 CCTGGCTGAGGGGAGCCCGGTGG - Intronic
1146646852 17:34581702-34581724 GCCGGCTTAGGCGAGCCCGGAGG + Intronic
1146789930 17:35745446-35745468 GCTGGCTTAGGGGAGCCAGTCGG + Exonic
1152453380 17:80397841-80397863 GACGGCTTAGGCCTGCCCTGTGG + Exonic
1163867415 19:19785715-19785737 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1166569234 19:43783176-43783198 GCAGGCTCAGGAGTGCCCGGCGG - Intergenic
1166682617 19:44778124-44778146 GCCGGCGGAGGCGGCCCCGGGGG + Exonic
934896993 2:98127753-98127775 CCCTGCTTAGGTGAGCCCAGAGG + Intronic
938702838 2:133894459-133894481 GTCGGCTTAGGCCTGCCCTGTGG + Intergenic
944490173 2:200250503-200250525 GAAGGCTTAGATGAGCCCGGTGG + Intergenic
947594327 2:231401266-231401288 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
947791463 2:232871648-232871670 GCCAGCCTAGGCGAGCCATGCGG + Intronic
1170401234 20:15985685-15985707 GGCGGCTTAGGCCTGCCCTGTGG - Intronic
1172010032 20:31841295-31841317 GCTGGCTAAGGCCAGCCCTGTGG + Intergenic
1179457146 21:41507741-41507763 GCCAGCTTTGGGGACCCCGGGGG + Intronic
1179553520 21:42158180-42158202 GCCGGCTTCTGAGAGCCCAGTGG + Intergenic
1182145077 22:27992569-27992591 GCCGGGTAAGTCGAGCCTGGAGG - Exonic
955927671 3:64023566-64023588 GCCGGGTGAGGCGTTCCCGGAGG - Intronic
960687831 3:120311975-120311997 GGCGGCTTAGGCCTGCCCAGTGG + Intergenic
966919366 3:184602025-184602047 GGCGGCTTCGGGGAGCCCCGGGG + Intronic
972991635 4:44828103-44828125 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
995473207 5:112524404-112524426 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
1002991837 6:2245623-2245645 GCCGGCCAAGGCGGGCCCGACGG + Exonic
1010317598 6:74468682-74468704 GGCGGCTTAGACGTGCCCTGTGG + Intergenic
1011564693 6:88662652-88662674 GGCGGCTTAGGCCTGCCCTGTGG + Intronic
1014547385 6:122748723-122748745 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1019365818 7:632312-632334 GCCGGCTTCGGCGAGGTGGGTGG - Intronic
1020323715 7:6958666-6958688 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1022489815 7:30808054-30808076 GGCGGCTTAGGCCTGCCCTGTGG + Intronic
1024043868 7:45574580-45574602 GGCGGCGCGGGCGAGCCCGGGGG + Exonic
1036372347 8:8172317-8172339 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic
1036817274 8:11911544-11911566 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1036878555 8:12493324-12493346 GGCGGCTTAGGCCTGCCCTGTGG - Intergenic
1039289393 8:36077576-36077598 GCTGGCTCAGGAGAGCCTGGGGG - Intergenic
1041226594 8:55706605-55706627 GGCGGCTTAGGCCTGCCCTGTGG + Intronic
1056228531 9:84521290-84521312 GCAGGTTTAGGGGAGCCAGGTGG + Intergenic
1056922334 9:90801806-90801828 GGCGGCTGAGGCCACCCCGGCGG + Exonic
1057490299 9:95515643-95515665 GCGGCCTCAGGGGAGCCCGGGGG - Intronic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1185909180 X:3966375-3966397 GGCGGCTTAGGCCTGCCCCGTGG + Intergenic
1190315601 X:49148568-49148590 GGCGGCTTAGGCCTGCCCTGCGG - Intergenic
1190426480 X:50338176-50338198 GGCGGCTTAGGCCTGCCCTGTGG - Intronic
1191918288 X:66225758-66225780 GGCGGCTTAGGCCTGCCCTGTGG - Intronic
1192523704 X:71823839-71823861 GCCGGCTCAGGCGACCCCCAGGG - Intergenic
1194399883 X:93430224-93430246 GGCGGCTTAGGCCTGCCCTGTGG + Intergenic