ID: 1146649125

View in Genome Browser
Species Human (GRCh38)
Location 17:34595853-34595875
Sequence ATTTGGGGAGGCGCCTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146649120_1146649125 0 Left 1146649120 17:34595830-34595852 CCTCTGGCTTCTTCAGGGACTGT 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1146649125 17:34595853-34595875 ATTTGGGGAGGCGCCTCAGTAGG 0: 1
1: 0
2: 1
3: 4
4: 69
1146649118_1146649125 5 Left 1146649118 17:34595825-34595847 CCTCACCTCTGGCTTCTTCAGGG 0: 1
1: 0
2: 2
3: 32
4: 341
Right 1146649125 17:34595853-34595875 ATTTGGGGAGGCGCCTCAGTAGG 0: 1
1: 0
2: 1
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146649125 Original CRISPR ATTTGGGGAGGCGCCTCAGT AGG Intronic