ID: 1146649638

View in Genome Browser
Species Human (GRCh38)
Location 17:34598636-34598658
Sequence TTTGATGTGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146649628_1146649638 4 Left 1146649628 17:34598609-34598631 CCCCTTTGTCATCCTCCCTGCAC 0: 1
1: 0
2: 3
3: 38
4: 345
Right 1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 27
4: 316
1146649629_1146649638 3 Left 1146649629 17:34598610-34598632 CCCTTTGTCATCCTCCCTGCACT 0: 1
1: 0
2: 2
3: 35
4: 365
Right 1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 27
4: 316
1146649631_1146649638 -8 Left 1146649631 17:34598621-34598643 CCTCCCTGCACTCCCTTTGATGT 0: 1
1: 0
2: 2
3: 10
4: 223
Right 1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 27
4: 316
1146649627_1146649638 19 Left 1146649627 17:34598594-34598616 CCAGATGAGATAAAGCCCCTTTG 0: 1
1: 0
2: 0
3: 4
4: 129
Right 1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 27
4: 316
1146649630_1146649638 2 Left 1146649630 17:34598611-34598633 CCTTTGTCATCCTCCCTGCACTC 0: 1
1: 0
2: 2
3: 41
4: 365
Right 1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 27
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146649638 Original CRISPR TTTGATGTGCAGAAGGTGGA AGG Intronic
901090825 1:6639928-6639950 TTTGATGATCAGACGGTGCATGG + Exonic
903438874 1:23372144-23372166 TTGGAGGTGGAGAAGGTGGGAGG + Intergenic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
907642851 1:56208841-56208863 TTTGCTGTGCAGAAGGTTTTTGG - Intergenic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
910082844 1:83362101-83362123 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
910770320 1:90824333-90824355 TTTGAGGTGGAGAAGAAGGAAGG - Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912719982 1:112011957-112011979 TTTGATGGGATGGAGGTGGAGGG - Intergenic
913576094 1:120176615-120176637 TTGGAAGTTAAGAAGGTGGAAGG - Intergenic
915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG + Intergenic
915563451 1:156700887-156700909 TTTGAGGAGCAGACTGTGGATGG - Exonic
918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG + Intergenic
918445536 1:184613563-184613585 TATGATGTGCAAAACGTTGATGG + Intronic
921291313 1:213660304-213660326 TTTCATGTCCAGAAGCTGTAGGG + Intergenic
921533644 1:216317058-216317080 TTTGCTGTGCAGAAGCTCCAAGG + Intronic
922397849 1:225221321-225221343 TTTGCTGTGCAGAAGGTCTTTGG - Intronic
923903262 1:238353445-238353467 TTTGCTGTGCAGAAGCTGGCTGG + Intergenic
924682723 1:246254126-246254148 TTTGATGTGCAGAAGTTCTTTGG + Intronic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063218907 10:3948356-3948378 TGGGATGTGGAGAGGGTGGAAGG + Intergenic
1063491314 10:6466231-6466253 TTAGATGTGGAGAAAGTGGTGGG + Intronic
1063761479 10:9083456-9083478 TTTGCTCTGCACAAAGTGGAAGG - Intergenic
1065264932 10:23965014-23965036 TTTAATGTGCAGCTGGGGGACGG - Intronic
1065467927 10:26045132-26045154 TTTGCTGGGCAGATGGTGGCTGG - Intronic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1069448491 10:68496134-68496156 TTTGATGTGCAGGAGACAGATGG - Intronic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1072212017 10:93254625-93254647 TTTGATGAGCAGATGGGGGCTGG + Intergenic
1072387833 10:94950236-94950258 TTGAATGGGCAGAAGCTGGAAGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075306103 10:121368764-121368786 GTTGAGGTGCAGAAGTGGGAAGG - Intergenic
1076039087 10:127227597-127227619 TTTCAGGTGCAGAAGGGGTAGGG - Intronic
1076631182 10:131853240-131853262 TTTGAGGTGCAGATGAGGGAAGG - Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081203428 11:40246337-40246359 TTTGATGTCTAGAAGGAGTATGG - Intronic
1082804435 11:57438589-57438611 TTTGAGGTGCACAAGTTAGAGGG - Intergenic
1083049999 11:59768602-59768624 GTTGATGAGCAGAAGGTGTCTGG + Intronic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084278304 11:68068213-68068235 TGTGTGGTGCAGAAGGGGGAAGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085154486 11:74280891-74280913 TTTGCTGTGCAGAATTTAGATGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086737115 11:90320442-90320464 TTTGAGGGGCAGAAGGCAGAAGG - Intergenic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1088970084 11:114766282-114766304 TTTGATTTATAGCAGGTGGAAGG - Intergenic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091358464 11:134956215-134956237 ATTGATGGGCAGAGGGTGAAGGG + Intergenic
1093450333 12:19306502-19306524 TTTGATGTGTTGAAGCAGGAGGG + Intronic
1093567784 12:20628935-20628957 TTTGATGATGTGAAGGTGGATGG + Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1094090660 12:26645415-26645437 TTGGATGGCCAGAAGGTGTAGGG + Intronic
1096382633 12:51172258-51172280 TTTGTTATTCAGAAGGTGTAGGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1099037225 12:77603659-77603681 TTTGATGAGCAGAAGCTGGATGG + Intergenic
1100214379 12:92432743-92432765 GTTGGTGGGCAGAAGTTGGAAGG - Intergenic
1100500874 12:95172947-95172969 TTTAATGTTAAGAAGGTGGGTGG + Intronic
1101173024 12:102119766-102119788 TTTAATGAGCAGTAGGTGTAGGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1104656014 12:130574618-130574640 TTTGATGTGCTGCAGATGGCTGG - Intronic
1104857438 12:131908701-131908723 TTTGCTGTGCAGAAGCCGCATGG - Exonic
1107747293 13:43524098-43524120 GATGATGTGAAGAAGGTGGTTGG - Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109247488 13:59973827-59973849 TTTTATGTGTAGAGGGTGCATGG + Intronic
1109582172 13:64355111-64355133 GTTGAAGGGTAGAAGGTGGATGG + Intergenic
1110309218 13:74027804-74027826 TTTTATGTGAAGAATGTGTATGG - Intronic
1110611356 13:77491584-77491606 GCAGATGTGGAGAAGGTGGAGGG + Intergenic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1111145669 13:84175876-84175898 TTTGCTGTGCAGAAGGTCTTTGG + Intergenic
1111786759 13:92796633-92796655 TTTGTTTTGAATAAGGTGGATGG - Intronic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1112579134 13:100663471-100663493 TTTTAAGTGCAGAAGGGGCAAGG + Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113972697 13:114202031-114202053 TTCGATGGGCAGAGGGTGGTGGG - Intergenic
1114992303 14:28301453-28301475 TTTGCTGTGCTGCAGGTGGCAGG + Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1116088004 14:40266279-40266301 TTTGCTGTGCAGAAGCTGAGGGG + Intergenic
1116127848 14:40812139-40812161 TTTGAGGTGTAGAACGTGGTAGG + Intergenic
1118285977 14:64473259-64473281 TTTGAGGTGGAGGAGGTGGCAGG - Exonic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1119310145 14:73639343-73639365 TTGGAGGTACAGAAGGTGGCAGG - Intergenic
1119310236 14:73640194-73640216 TTTTTGGTGGAGAAGGTGGAAGG - Intergenic
1119897624 14:78233176-78233198 TTTGATGTGCACATCCTGGAAGG + Intergenic
1120899500 14:89563618-89563640 TTAGATGGGCAGAAAGGGGAGGG + Intronic
1121433413 14:93903204-93903226 TTTGCTGTGGAGCAGGTGGAGGG + Intergenic
1121983535 14:98476424-98476446 TTTGTTGGGGAGAATGTGGACGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126739166 15:51760382-51760404 TTTGCTTTGAAGATGGTGGAAGG - Intronic
1126980173 15:54232908-54232930 TTTGATGTTTTGAATGTGGAAGG + Intronic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128251848 15:66169325-66169347 TTTGTTGGGCAGACGGTGGAGGG - Intronic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1130761569 15:86826172-86826194 TTTGATGTGTAGAAGCTTTAAGG - Intronic
1131114095 15:89783677-89783699 TTTGATGTGCAGATGGTGGTGGG + Intergenic
1131585362 15:93687232-93687254 TTTGCTGTGCAGAAGCTCGTTGG - Intergenic
1131900050 15:97077918-97077940 TTTCCTGGGCAGAAGGTGGGTGG - Intergenic
1132924778 16:2423437-2423459 TTTGATCTTCAGAAGATGCAGGG - Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134385071 16:13764093-13764115 TTTGATGAGGTGAATGTGGAGGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140710022 16:77668993-77669015 TTTGTTGTTCAGAAGGAGAAAGG - Intergenic
1140878983 16:79180284-79180306 TTAAGTGTGCACAAGGTGGAAGG + Intronic
1142341757 16:89528026-89528048 AGTGATGTACAGAAGATGGAGGG + Intronic
1142341848 16:89528523-89528545 GATGATGTACAGAAGATGGAGGG + Intronic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1146603996 17:34242491-34242513 TTTGTTTTGCAGAAAATGGAAGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1150918066 17:69456527-69456549 TGTGACGTTCATAAGGTGGATGG + Intronic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152617526 17:81344927-81344949 TTTGACGTGCACATGGGGGAGGG + Intergenic
1154338078 18:13481890-13481912 TTTGCTGGGCAGGAGGGGGAAGG + Intronic
1154496481 18:14965003-14965025 ATTGATGGGCAGAGGGTGAAGGG - Intergenic
1155434181 18:25794075-25794097 TTAGATGTGCAGAAGCAAGAGGG - Intergenic
1156328983 18:36101601-36101623 TTTGTAGTTCAGCAGGTGGAAGG + Intergenic
1158418999 18:57275988-57276010 TGTGATGTGAAGGAGGTAGAAGG - Intergenic
1158736009 18:60080510-60080532 TTTGTTGTGCAGAAGCTGTTTGG - Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1162132454 19:8535337-8535359 TTTGATTTGGAGAAGACGGACGG - Intronic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1166424990 19:42669724-42669746 TTTGCAGTGCAGATGATGGAGGG - Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925746917 2:7051321-7051343 TTGGAGGTGGAGCAGGTGGACGG + Intronic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927530115 2:23789385-23789407 TTTGGTGTCTAGAAGGTAGAAGG - Intronic
927631208 2:24775706-24775728 TTTGAGGTGCTGGAGGTGGGAGG - Intergenic
927960755 2:27239397-27239419 TTTGAAGGGCAGAAAGTGAAGGG + Exonic
927972956 2:27317094-27317116 TTTCATGCGCAGAAGGCAGAGGG + Intronic
928685973 2:33749068-33749090 ATACATGTGCAGAAGGTGCAGGG - Intergenic
928726493 2:34179784-34179806 TTAGATTTGCAGAATGTTGAAGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
931337483 2:61361828-61361850 TTTGCTGTGCAGAAGCTTGTTGG - Intronic
931534145 2:63253404-63253426 TTTGATGTGCAGAAGCTCTTTGG - Intronic
932521324 2:72416546-72416568 TTTGCTGGGCAGAAGATGCAGGG + Intronic
933481017 2:82857326-82857348 TTTGATGTCCAGGAGGAGAAAGG + Intergenic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
936741760 2:115520369-115520391 TTTGATGGGCTGGAGGTTGAGGG + Intronic
939711009 2:145520109-145520131 TTTGCTGTGCAGAAGCTGTTTGG + Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941465137 2:165816703-165816725 TTGGAAGGGTAGAAGGTGGATGG + Intergenic
943045088 2:182851199-182851221 TTTGATGTGCAGAAGCTTTTTGG + Intronic
943802957 2:192085405-192085427 TTTGATGTGCAGAAAATGCCAGG - Intronic
944206333 2:197162412-197162434 TTTGGTGGGAAGAAGGTAGAAGG - Intronic
945660027 2:212674449-212674471 TTTGCTGTGCAGAAGCTGTTCGG + Intergenic
946437059 2:219664210-219664232 TCTGTTGTGCAAAAGGAGGAGGG + Intergenic
948138451 2:235655197-235655219 TTAAATGTACAGAAGCTGGAAGG + Intronic
948288466 2:236806170-236806192 TTTGATGTGAAATAGCTGGAGGG + Intergenic
948665383 2:239531556-239531578 TTTGATGCATAGAAGGTGGGAGG + Intergenic
1170041299 20:12042644-12042666 TTTGCTGTGCAGAAGGTCTTTGG + Intergenic
1170514188 20:17110811-17110833 TTTGATGTGCAGAAGCTTTTTGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172719245 20:36986727-36986749 CTTGATGTCCAGAAGGTGACAGG - Intergenic
1174080349 20:47967073-47967095 TTTGCTCTGGACAAGGTGGATGG - Intergenic
1174430362 20:50464050-50464072 TTTGATGCCCAGAAAGTGCATGG - Intergenic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1177512223 21:22103204-22103226 TTTGCTGTGCAGAAGGTTTTTGG + Intergenic
1178362377 21:31959210-31959232 TGTTTTGTGCAGAAGGAGGAAGG - Intronic
1181834987 22:25597976-25597998 TGTGTTGGGCAGAAGGTGTATGG + Intronic
1182024957 22:27110910-27110932 ATTGTTGTTCAGAAGGGGGAAGG + Intergenic
1182107469 22:27699580-27699602 ATTAATGTGGAGAAGGTGCATGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
950148530 3:10668652-10668674 TTTGAAGTGCAGAAGGGGTGGGG - Intronic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
953695188 3:45152738-45152760 TTTGATGGAAAGAAAGTGGAGGG + Intergenic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
959255970 3:104014433-104014455 TTTGATGTGCAGAAGCTGTTTGG - Intergenic
959356221 3:105332529-105332551 TTTGCTGTGCAGAAGCTTGTTGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963205703 3:142631882-142631904 TTTGATGTGCAGAAGTTTTTTGG - Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
963924837 3:150940290-150940312 TGTGATTAGCAGAATGTGGATGG + Intronic
964431198 3:156607776-156607798 TTTGATGTGCAGAAGTTTTCAGG + Intergenic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965244868 3:166254774-166254796 TTACATGTGCAGAACGTGCAGGG - Intergenic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968912035 4:3481310-3481332 ATTGAGGTCCAGAAGATGGAGGG + Intronic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
972445616 4:39140622-39140644 TTTGCTGTGTGGAAGCTGGAAGG - Intergenic
974404334 4:61446504-61446526 TATGATGTGAAGAATTTGGAGGG - Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975997406 4:80332217-80332239 TATGTTGGGCAGAAAGTGGAAGG + Intronic
978092318 4:104732745-104732767 TTTGAGGTGCAGGAGATTGAAGG - Intergenic
979136661 4:117118694-117118716 TTTGCTGTGCTGCAGGTGGTGGG - Intergenic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
980434417 4:132749965-132749987 GTTGATGAGTAGAAGCTGGAAGG - Intergenic
981442357 4:144797578-144797600 TTTGAGTTGCTTAAGGTGGAAGG - Intergenic
981716152 4:147754349-147754371 TTTGATGCACAGGAGGTGAAAGG + Intronic
981884868 4:149662380-149662402 TTCCATGTGCAGATGTTGGATGG + Intergenic
983350146 4:166576328-166576350 TTTGAAGTGCAGACAGTGGGAGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983996291 4:174186699-174186721 TTTGCTGTGCAGAAGGTCTTTGG - Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
987378575 5:17261617-17261639 TTTGTTATGCAGACGGTGGGGGG - Intronic
988776002 5:34478575-34478597 TTTGAGGGGCAGAAGGCAGAAGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990134166 5:52625105-52625127 TTTGATGTGCAGAAGCTCTTGGG + Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
991563954 5:67985254-67985276 GATGAAGTGGAGAAGGTGGAAGG + Intergenic
992284502 5:75220154-75220176 TTTGCTGTGCAGAAGCTGTTTGG - Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992770465 5:80042597-80042619 TTTAATGGGCAGTAGGTAGAGGG + Intronic
993345673 5:86779270-86779292 TTTGATGTGCAGAAGCTTTTTGG + Intergenic
993879697 5:93347987-93348009 TACAATGTGCAGCAGGTGGACGG - Intergenic
994192914 5:96888301-96888323 ATGGATGTGCAGGAGGTGAATGG + Intronic
994830574 5:104777069-104777091 TTTAATGTGCCTAAGGTTGAAGG + Intergenic
995752308 5:115465682-115465704 TTTGCTGTGCAGAGGGTGTTTGG - Intergenic
996022783 5:118610191-118610213 TCTGATGCACAGAAGCTGGATGG + Intergenic
996572807 5:124950699-124950721 TCTGAAGTGCTGAAGGTTGAAGG - Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
999109914 5:149110196-149110218 TGTGATGCGCAGATGGTGGAAGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
1000138802 5:158381378-158381400 TTAGATGTGCAAAAGGTGAAAGG + Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1002107134 5:176885320-176885342 TTTGCTGTGCAGAATTTGCAGGG - Intronic
1002201183 5:177529363-177529385 TGTGAAGTCCAGGAGGTGGAAGG + Intronic
1004324810 6:14665070-14665092 TGTCCTGTACAGAAGGTGGAAGG - Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007000501 6:38307818-38307840 TTTGAGGGGCAAAAGGTGGAGGG - Intronic
1007505743 6:42333866-42333888 CTTGATGACCAGAAGGTGGTCGG - Intronic
1008649322 6:53547305-53547327 TATGGTGTGCAGCAGGTGTATGG - Intronic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1008676442 6:53824464-53824486 TTTGCTGTGCAGAAGCTGTTTGG + Intronic
1010167055 6:72927935-72927957 TGTAATGTGCAGAAGGTGTTAGG - Intronic
1010575460 6:77524446-77524468 ATACATGTGCAGAAGGTGCAGGG - Intergenic
1011342657 6:86334440-86334462 TTTGAGGTACAGAAGGTCAAGGG - Intergenic
1011736336 6:90314087-90314109 TTTGATGTGCAGCAGGCAGTTGG + Intergenic
1011985292 6:93436068-93436090 TTTGATGTGCAGAAGCTCTTTGG - Intergenic
1012134194 6:95535668-95535690 TTTGCTGTGCAGAAGGTCTTTGG + Intergenic
1012741531 6:103021756-103021778 TTTGAAGGGTAGAAGGTGGGAGG - Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015500332 6:133925650-133925672 TTTGATGTGATGCAGGGGGATGG - Intergenic
1015735523 6:136395533-136395555 TTTGCTGTGCAGAAGGTTTTTGG + Intronic
1016183142 6:141171390-141171412 TTTGATGGGCACAAGATGGGGGG + Intergenic
1016326810 6:142912420-142912442 TGTGATGAGGAGAAGGGGGAAGG - Intronic
1016638941 6:146326435-146326457 TTTGAGGGGCAGAGGGTGAAAGG + Intronic
1017429755 6:154359426-154359448 TTTGCTGTGCAGAGGCTGGGCGG - Intronic
1018540811 6:164877299-164877321 TTTGATCCTCAAAAGGTGGAAGG + Intergenic
1020071560 7:5230270-5230292 TGTGAAGTGCAGAAGCTGTAGGG + Intronic
1020508781 7:9025715-9025737 ATTGATTTGCAGAGGGTGCATGG - Intergenic
1020699345 7:11459220-11459242 ATTGAGGTCCAGAAGGTGAAGGG + Intronic
1021003521 7:15363684-15363706 TTTGATGATGAGATGGTGGAGGG - Intronic
1021592071 7:22274266-22274288 TTTCAGGTCCAGAAGGTAGATGG - Intronic
1021654453 7:22861601-22861623 TTTGAAGGGCAGAAGGTGCAGGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024505120 7:50156193-50156215 TTTGATGTGAAGAGCCTGGAAGG - Intronic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1027299679 7:76818307-76818329 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1030863210 7:114663687-114663709 TTTGATGTGAAGAAGCAAGAAGG + Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1034803098 7:154065167-154065189 TGTGATGAGCAGCAGCTGGAAGG + Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1038150594 8:24939935-24939957 TTTAATCTGCTGAAGGTGGGGGG - Intergenic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1039951826 8:42178991-42179013 TGTGATGTGCAGCGGCTGGATGG + Exonic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040727341 8:50398278-50398300 TATGATGGGCAGATGGTGGACGG - Intronic
1041625209 8:60017669-60017691 TTTGTTGAGAAGAAGGTGGATGG + Intergenic
1041635334 8:60136732-60136754 TTTGAGGTTCAGAAGCTGAAAGG + Intergenic
1044725466 8:95191085-95191107 TTTGAAGTGCTTGAGGTGGAGGG + Intergenic
1046350893 8:113010146-113010168 TCTGCTGTGCACAAGGTGGGCGG - Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1049755605 8:144310090-144310112 TTCCATGTGCAGAAGGGGGTTGG + Intronic
1050224380 9:3434686-3434708 TTTGGAGTGCAGAAGGAGGGTGG - Intronic
1051701357 9:19827648-19827670 TTTGATTTGCAGAATGAGGGAGG - Intergenic
1053418405 9:37961307-37961329 TTTCATGTGGAGAAGGTGCTTGG + Intronic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055342882 9:75303959-75303981 TTTGATGTGCAGAAGCTCTTTGG + Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1057048845 9:91906735-91906757 TTTGGTTTGCAGTAGCTGGAGGG + Intronic
1057376795 9:94531951-94531973 TTTGCTGTACAGAAGGTGTAAGG - Intergenic
1057410177 9:94810958-94810980 TTTGATGGGCTGAAGGAAGAAGG - Intronic
1058290153 9:103230880-103230902 TTTGTTGTTGAGAAGGTGGCAGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1060044383 9:120328090-120328112 TGTGAGGGGCAGAAGGTGGGGGG + Intergenic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1189351560 X:40279517-40279539 TATGATGGGCTGAAAGTGGAGGG + Intergenic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1189728285 X:43990807-43990829 ATTGGAGTGCAGCAGGTGGAAGG - Intergenic
1190191717 X:48282128-48282150 TTTGATGTGCAGAACATGGCTGG + Intergenic
1190241086 X:48658760-48658782 TTTTATTTGCAGAAGGTAAAAGG - Intergenic
1190243500 X:48676103-48676125 TTTGATCTGCAGGAGTAGGACGG - Intergenic
1190308525 X:49100872-49100894 TTTGATCTGCAGGAGTAGGACGG - Intronic
1192173864 X:68874017-68874039 TTTGATGAGCAGAAGTTGCTTGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1194098350 X:89671916-89671938 ATACATGTGCAGAACGTGGAGGG + Intergenic
1195117847 X:101717749-101717771 TTTGATGTGTTGAAGGTACATGG - Intergenic
1197366345 X:125568205-125568227 TTTGAAGAGCAGGAGGTTGAGGG - Intergenic
1198219886 X:134589399-134589421 TTTCATGTGCAGAAGATTCAGGG + Intronic
1198749528 X:139924659-139924681 TTTGCTGTGTACCAGGTGGAGGG + Intronic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1200451373 Y:3333294-3333316 ATACATGTGCAGAACGTGGAGGG + Intergenic
1200502872 Y:3973472-3973494 TTTAAAGTGCAAAAGGTGAAGGG + Intergenic
1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG + Intergenic