ID: 1146656964

View in Genome Browser
Species Human (GRCh38)
Location 17:34640108-34640130
Sequence GCTGCTTCTGGGACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146656964_1146656968 -7 Left 1146656964 17:34640108-34640130 CCAGCATGTGTCCCAGAAGCAGC No data
Right 1146656968 17:34640124-34640146 AAGCAGCCAGCAGCAGAACTGGG No data
1146656964_1146656971 3 Left 1146656964 17:34640108-34640130 CCAGCATGTGTCCCAGAAGCAGC No data
Right 1146656971 17:34640134-34640156 CAGCAGAACTGGGGCTACACTGG No data
1146656964_1146656967 -8 Left 1146656964 17:34640108-34640130 CCAGCATGTGTCCCAGAAGCAGC No data
Right 1146656967 17:34640123-34640145 GAAGCAGCCAGCAGCAGAACTGG No data
1146656964_1146656969 -6 Left 1146656964 17:34640108-34640130 CCAGCATGTGTCCCAGAAGCAGC No data
Right 1146656969 17:34640125-34640147 AGCAGCCAGCAGCAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146656964 Original CRISPR GCTGCTTCTGGGACACATGC TGG (reversed) Intergenic
No off target data available for this crispr