ID: 1146658081

View in Genome Browser
Species Human (GRCh38)
Location 17:34646883-34646905
Sequence GTGGATGGAGAGAGGCCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146658074_1146658081 4 Left 1146658074 17:34646856-34646878 CCTGGAGAGATGATTAAAACCCT No data
Right 1146658081 17:34646883-34646905 GTGGATGGAGAGAGGCCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146658081 Original CRISPR GTGGATGGAGAGAGGCCTGT CGG Intergenic
No off target data available for this crispr