ID: 1146659456

View in Genome Browser
Species Human (GRCh38)
Location 17:34654680-34654702
Sequence CCCCGACCACTGGCTTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146659453_1146659456 -7 Left 1146659453 17:34654664-34654686 CCATTCTCTCACTCTGCCCCGAC No data
Right 1146659456 17:34654680-34654702 CCCCGACCACTGGCTTACTTTGG No data
1146659452_1146659456 20 Left 1146659452 17:34654637-34654659 CCTGGCAAAAAGGGGAAGCAAAG No data
Right 1146659456 17:34654680-34654702 CCCCGACCACTGGCTTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146659456 Original CRISPR CCCCGACCACTGGCTTACTT TGG Intergenic
No off target data available for this crispr