ID: 1146660983

View in Genome Browser
Species Human (GRCh38)
Location 17:34665034-34665056
Sequence TATAAAGGAACAGCTGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146660981_1146660983 -9 Left 1146660981 17:34665020-34665042 CCATTTTGCACTGTTATAAAGGA No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660979_1146660983 5 Left 1146660979 17:34665006-34665028 CCTTGTGTGTTTGTCCATTTTGC No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660978_1146660983 11 Left 1146660978 17:34665000-34665022 CCTGGGCCTTGTGTGTTTGTCCA No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660975_1146660983 19 Left 1146660975 17:34664992-34665014 CCTTCCACCCTGGGCCTTGTGTG No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660976_1146660983 15 Left 1146660976 17:34664996-34665018 CCACCCTGGGCCTTGTGTGTTTG No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660974_1146660983 20 Left 1146660974 17:34664991-34665013 CCCTTCCACCCTGGGCCTTGTGT No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data
1146660977_1146660983 12 Left 1146660977 17:34664999-34665021 CCCTGGGCCTTGTGTGTTTGTCC No data
Right 1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146660983 Original CRISPR TATAAAGGAACAGCTGGCGC TGG Intergenic
No off target data available for this crispr