ID: 1146661548

View in Genome Browser
Species Human (GRCh38)
Location 17:34668160-34668182
Sequence CCATTCCCACCAAGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146661548_1146661556 -9 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661556 17:34668174-34668196 TGGGAATGGTCCAGGGGAGGAGG No data
1146661548_1146661561 3 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661561 17:34668186-34668208 AGGGGAGGAGGGAAGGGTAATGG No data
1146661548_1146661559 -3 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661559 17:34668180-34668202 TGGTCCAGGGGAGGAGGGAAGGG No data
1146661548_1146661557 -8 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661557 17:34668175-34668197 GGGAATGGTCCAGGGGAGGAGGG No data
1146661548_1146661562 7 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661562 17:34668190-34668212 GAGGAGGGAAGGGTAATGGCTGG No data
1146661548_1146661558 -4 Left 1146661548 17:34668160-34668182 CCCAGAGGCCTTGGTGGGAATGG No data
Right 1146661558 17:34668179-34668201 ATGGTCCAGGGGAGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146661548 Original CRISPR CCATTCCCACCAAGGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr