ID: 1146663460

View in Genome Browser
Species Human (GRCh38)
Location 17:34681014-34681036
Sequence TTGTACTGGCGAGGATACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146663453_1146663460 13 Left 1146663453 17:34680978-34681000 CCTGTGAGGCAGATACTGTTACT No data
Right 1146663460 17:34681014-34681036 TTGTACTGGCGAGGATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146663460 Original CRISPR TTGTACTGGCGAGGATACAG TGG Intergenic
No off target data available for this crispr