ID: 1146664080

View in Genome Browser
Species Human (GRCh38)
Location 17:34685288-34685310
Sequence CCCTGTTGCCACAGAGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146664075_1146664080 3 Left 1146664075 17:34685262-34685284 CCTGGGATGCCACATGAAACAGA No data
Right 1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG No data
1146664077_1146664080 -6 Left 1146664077 17:34685271-34685293 CCACATGAAACAGATGGCCCTGT No data
Right 1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG No data
1146664073_1146664080 9 Left 1146664073 17:34685256-34685278 CCCTGGCCTGGGATGCCACATGA No data
Right 1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG No data
1146664072_1146664080 10 Left 1146664072 17:34685255-34685277 CCCCTGGCCTGGGATGCCACATG No data
Right 1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG No data
1146664074_1146664080 8 Left 1146664074 17:34685257-34685279 CCTGGCCTGGGATGCCACATGAA No data
Right 1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146664080 Original CRISPR CCCTGTTGCCACAGAGACCA GGG Intergenic
No off target data available for this crispr