ID: 1146666603

View in Genome Browser
Species Human (GRCh38)
Location 17:34709199-34709221
Sequence CAAGCTGGCCTCTTTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146666596_1146666603 29 Left 1146666596 17:34709147-34709169 CCAAGCAGAGGCAGGGAACAGAG No data
Right 1146666603 17:34709199-34709221 CAAGCTGGCCTCTTTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146666603 Original CRISPR CAAGCTGGCCTCTTTGTTCC TGG Intergenic
No off target data available for this crispr