ID: 1146671328

View in Genome Browser
Species Human (GRCh38)
Location 17:34740159-34740181
Sequence AAAAAGTCACAATTACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146671328_1146671329 -10 Left 1146671328 17:34740159-34740181 CCACTTTGTAATTGTGACTTTTT No data
Right 1146671329 17:34740172-34740194 GTGACTTTTTACCCTGAAAGTGG No data
1146671328_1146671331 -6 Left 1146671328 17:34740159-34740181 CCACTTTGTAATTGTGACTTTTT No data
Right 1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG No data
1146671328_1146671330 -9 Left 1146671328 17:34740159-34740181 CCACTTTGTAATTGTGACTTTTT No data
Right 1146671330 17:34740173-34740195 TGACTTTTTACCCTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146671328 Original CRISPR AAAAAGTCACAATTACAAAG TGG (reversed) Intergenic
No off target data available for this crispr