ID: 1146671331

View in Genome Browser
Species Human (GRCh38)
Location 17:34740176-34740198
Sequence CTTTTTACCCTGAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146671327_1146671331 19 Left 1146671327 17:34740134-34740156 CCTGAGAATGAAGCTCATGCTTT No data
Right 1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG No data
1146671328_1146671331 -6 Left 1146671328 17:34740159-34740181 CCACTTTGTAATTGTGACTTTTT No data
Right 1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146671331 Original CRISPR CTTTTTACCCTGAAAGTGGG TGG Intergenic
No off target data available for this crispr