ID: 1146673018

View in Genome Browser
Species Human (GRCh38)
Location 17:34755054-34755076
Sequence AGAAAGCTGCTCCTCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146673018_1146673028 29 Left 1146673018 17:34755054-34755076 CCATCAGGGAGGAGCAGCTTTCT No data
Right 1146673028 17:34755106-34755128 GACAACCTCAGGAGTCACCAAGG No data
1146673018_1146673027 18 Left 1146673018 17:34755054-34755076 CCATCAGGGAGGAGCAGCTTTCT No data
Right 1146673027 17:34755095-34755117 AAAAAGATTCTGACAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146673018 Original CRISPR AGAAAGCTGCTCCTCCCTGA TGG (reversed) Intergenic
No off target data available for this crispr