ID: 1146677218

View in Genome Browser
Species Human (GRCh38)
Location 17:34781830-34781852
Sequence ATTAGCTGCGGGGTAACGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146677202_1146677218 30 Left 1146677202 17:34781777-34781799 CCCCCACAGCCATCACCTTCGAG No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677208_1146677218 15 Left 1146677208 17:34781792-34781814 CCTTCGAGCCACACGGCTGCTGC No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677209_1146677218 7 Left 1146677209 17:34781800-34781822 CCACACGGCTGCTGCCACAGCCA No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677210_1146677218 -7 Left 1146677210 17:34781814-34781836 CCACAGCCACCAGCTAATTAGCT No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677207_1146677218 21 Left 1146677207 17:34781786-34781808 CCATCACCTTCGAGCCACACGGC No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677203_1146677218 29 Left 1146677203 17:34781778-34781800 CCCCACAGCCATCACCTTCGAGC No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677204_1146677218 28 Left 1146677204 17:34781779-34781801 CCCACAGCCATCACCTTCGAGCC No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data
1146677205_1146677218 27 Left 1146677205 17:34781780-34781802 CCACAGCCATCACCTTCGAGCCA No data
Right 1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146677218 Original CRISPR ATTAGCTGCGGGGTAACGAG GGG Intergenic
No off target data available for this crispr