ID: 1146677619

View in Genome Browser
Species Human (GRCh38)
Location 17:34784405-34784427
Sequence GAAGCCACTGGAAGTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146677612_1146677619 25 Left 1146677612 17:34784357-34784379 CCTTGAATGTTCATGTAAGGAGT No data
Right 1146677619 17:34784405-34784427 GAAGCCACTGGAAGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146677619 Original CRISPR GAAGCCACTGGAAGTCCTTG AGG Intergenic
No off target data available for this crispr