ID: 1146679370

View in Genome Browser
Species Human (GRCh38)
Location 17:34796095-34796117
Sequence GTTTTTGAGTGGCTTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146679370_1146679384 27 Left 1146679370 17:34796095-34796117 CCCTTCTCAAGCCACTCAAAAAC No data
Right 1146679384 17:34796145-34796167 CCCAACATGGAGCTGGAAGGTGG No data
1146679370_1146679379 20 Left 1146679370 17:34796095-34796117 CCCTTCTCAAGCCACTCAAAAAC No data
Right 1146679379 17:34796138-34796160 TCCTGGCCCCAACATGGAGCTGG No data
1146679370_1146679375 3 Left 1146679370 17:34796095-34796117 CCCTTCTCAAGCCACTCAAAAAC No data
Right 1146679375 17:34796121-34796143 CCCCAGATGCACTGAGCTCCTGG No data
1146679370_1146679378 14 Left 1146679370 17:34796095-34796117 CCCTTCTCAAGCCACTCAAAAAC No data
Right 1146679378 17:34796132-34796154 CTGAGCTCCTGGCCCCAACATGG No data
1146679370_1146679381 24 Left 1146679370 17:34796095-34796117 CCCTTCTCAAGCCACTCAAAAAC No data
Right 1146679381 17:34796142-34796164 GGCCCCAACATGGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146679370 Original CRISPR GTTTTTGAGTGGCTTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr