ID: 1146685288

View in Genome Browser
Species Human (GRCh38)
Location 17:34837351-34837373
Sequence CCTGTCCTGCACCAGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685288_1146685298 23 Left 1146685288 17:34837351-34837373 CCCAAGCCCTGGTGCAGGACAGG No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685288_1146685294 4 Left 1146685288 17:34837351-34837373 CCCAAGCCCTGGTGCAGGACAGG No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685288_1146685299 24 Left 1146685288 17:34837351-34837373 CCCAAGCCCTGGTGCAGGACAGG No data
Right 1146685299 17:34837398-34837420 AGGCCCAGCAGAGAGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685288 Original CRISPR CCTGTCCTGCACCAGGGCTT GGG (reversed) Intergenic
No off target data available for this crispr