ID: 1146685294

View in Genome Browser
Species Human (GRCh38)
Location 17:34837378-34837400
Sequence CACCCTGAAGATGTTCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685291_1146685294 -2 Left 1146685291 17:34837357-34837379 CCCTGGTGCAGGACAGGTAGCCA No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685290_1146685294 3 Left 1146685290 17:34837352-34837374 CCAAGCCCTGGTGCAGGACAGGT No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685284_1146685294 30 Left 1146685284 17:34837325-34837347 CCAAATGCCTTCTGGTATTTGGA No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685288_1146685294 4 Left 1146685288 17:34837351-34837373 CCCAAGCCCTGGTGCAGGACAGG No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685292_1146685294 -3 Left 1146685292 17:34837358-34837380 CCTGGTGCAGGACAGGTAGCCAC No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data
1146685285_1146685294 23 Left 1146685285 17:34837332-34837354 CCTTCTGGTATTTGGAATTCCCA No data
Right 1146685294 17:34837378-34837400 CACCCTGAAGATGTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685294 Original CRISPR CACCCTGAAGATGTTCTACC AGG Intergenic
No off target data available for this crispr